perlretut(1) - phpMan

PERLRETUT(1)           Perl Programmers Reference Guide           PERLRETUT(1)

NAME
       perlretut - Perl regular expressions tutorial
DESCRIPTION
       This page provides a basic tutorial on understanding, creating and
       using regular expressions in Perl.  It serves as a complement to the
       reference page on regular expressions perlre.  Regular expressions are
       an integral part of the "m//", "s///", "qr//" and "split" operators and
       so this tutorial also overlaps with "Regexp Quote-Like Operators" in
       perlop and "split" in perlfunc.
       Perl is widely renowned for excellence in text processing, and regular
       expressions are one of the big factors behind this fame.  Perl regular
       expressions display an efficiency and flexibility unknown in most other
       computer languages.  Mastering even the basics of regular expressions
       will allow you to manipulate text with surprising ease.
       What is a regular expression?  A regular expression is simply a string
       that describes a pattern.  Patterns are in common use these days; exam-
       ples are the patterns typed into a search engine to find web pages and
       the patterns used to list files in a directory, e.g., "ls *.txt" or
       "dir *.*".  In Perl, the patterns described by regular expressions are
       used to search strings, extract desired parts of strings, and to do
       search and replace operations.
       Regular expressions have the undeserved reputation of being abstract
       and difficult to understand.  Regular expressions are constructed using
       simple concepts like conditionals and loops and are no more difficult
       to understand than the corresponding "if" conditionals and "while"
       loops in the Perl language itself.  In fact, the main challenge in
       learning regular expressions is just getting used to the terse notation
       used to express these concepts.
       This tutorial flattens the learning curve by discussing regular expres-
       sion concepts, along with their notation, one at a time and with many
       examples.  The first part of the tutorial will progress from the sim-
       plest word searches to the basic regular expression concepts.  If you
       master the first part, you will have all the tools needed to solve
       about 98% of your needs.  The second part of the tutorial is for those
       comfortable with the basics and hungry for more power tools.  It dis-
       cusses the more advanced regular expression operators and introduces
       the latest cutting edge innovations in 5.6.0.
       A note: to save time, 'regular expression' is often abbreviated as reg-
       exp or regex.  Regexp is a more natural abbreviation than regex, but is
       harder to pronounce.  The Perl pod documentation is evenly split on
       regexp vs regex; in Perl, there is more than one way to abbreviate it.
       We'll use regexp in this tutorial.
Part 1: The basics
       Simple word matching
       The simplest regexp is simply a word, or more generally, a string of
       characters.  A regexp consisting of a word matches any string that con-
       tains that word:
           "Hello World" =~ /World/;  # matches
       What is this perl statement all about? "Hello World" is a simple double
       quoted string.  "World" is the regular expression and the "//" enclos-
       ing "/World/" tells perl to search a string for a match.  The operator
       "=~" associates the string with the regexp match and produces a true
       value if the regexp matched, or false if the regexp did not match.  In
       our case, "World" matches the second word in "Hello World", so the
       expression is true.  Expressions like this are useful in conditionals:
           if ("Hello World" =~ /World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }
       There are useful variations on this theme.  The sense of the match can
       be reversed by using "!~" operator:
           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }
       The literal string in the regexp can be replaced by a variable:
           $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }
       If you're matching against the special default variable $_, the "$_ =~"
       part can be omitted:
           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }
       And finally, the "//" default delimiters for a match can be changed to
       arbitrary delimiters by putting an 'm' out front:
           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the matching '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                        # '/' becomes an ordinary char
       "/World/", "m!World!", and "m{World}" all represent the same thing.
       When, e.g., "" is used as a delimiter, the forward slash '/' becomes an
       ordinary character and can be used in a regexp without trouble.
       Let's consider how different regexps would match "Hello World":
           "Hello World" =~ /world/;  # doesn't match
           "Hello World" =~ /o W/;    # matches
           "Hello World" =~ /oW/;     # doesn't match
           "Hello World" =~ /World /; # doesn't match
       The first regexp "world" doesn't match because regexps are case-sensi-
       tive.  The second regexp matches because the substring 'o W'  occurs in
       the string "Hello World" .  The space character ' ' is treated like any
       other character in a regexp and is needed to match in this case.  The
       lack of a space character is the reason the third regexp 'oW' doesn't
       match.  The fourth regexp 'World ' doesn't match because there is a
       space at the end of the regexp, but not at the end of the string.  The
       lesson here is that regexps must match a part of the string exactly in
       order for the statement to be true.
       If a regexp matches in more than one place in the string, perl will
       always match at the earliest possible point in the string:
           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'
       With respect to character matching, there are a few more points you
       need to know about.   First of all, not all characters can be used 'as
       is' in a match.  Some characters, called metacharacters, are reserved
       for use in regexp notation.  The metacharacters are
           {}[]()^$.|*+?\
       The significance of each of these will be explained in the rest of the
       tutorial, but for now, it is important only to know that a metacharac-
       ter can be matched by putting a backslash before it:
           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "/usr/bin/perl" =~ /\/usr\/bin\/perl/;  # matches
       In the last regexp, the forward slash '/' is also backslashed, because
       it is used to delimit the regexp.  This can lead to LTS (leaning tooth-
       pick syndrome), however, and it is often more readable to change delim-
       iters.
           "/usr/bin/perl" =~ m!/usr/bin/perl!;    # easier to read
       The backslash character '\' is a metacharacter itself and needs to be
       backslashed:
           'C:\WIN32' =~ /C:\\WIN/;   # matches
       In addition to the metacharacters, there are some ASCII characters
       which don't have printable character equivalents and are instead repre-
       sented by escape sequences.  Common examples are "\t" for a tab, "\n"
       for a newline, "\r" for a carriage return and "\a" for a bell.  If your
       string is better thought of as a sequence of arbitrary bytes, the octal
       escape sequence, e.g., "\033", or hexadecimal escape sequence, e.g.,
       "\x1B" may be a more natural representation for your bytes.  Here are
       some examples of escapes:
           "1000\t2000" =~ m(0\t2)   # matches
           "1000\n2000" =~ /0\n20/   # matches
           "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
           "cat"        =~ /\143\x61\x74/ # matches, but a weird way to spell cat
       If you've been around Perl a while, all this talk of escape sequences
       may seem familiar.  Similar escape sequences are used in double-quoted
       strings and in fact the regexps in Perl are mostly treated as double-
       quoted strings.  This means that variables can be used in regexps as
       well.  Just like double-quoted strings, the values of the variables in
       the regexp will be substituted in before the regexp is evaluated for
       matching purposes.  So we have:
           $foo = 'house';
           'housecat' =~ /$foo/;      # matches
           'cathouse' =~ /cat$foo/;   # matches
           'housecat' =~ /${foo}cat/; # matches
       So far, so good.  With the knowledge above you can already perform
       searches with just about any literal string regexp you can dream up.
       Here is a very simple emulation of the Unix grep program:
           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D
           % chmod +x simple_grep
           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards
       This program is easy to understand.  "#!/usr/bin/perl" is the standard
       way to invoke a perl program from the shell.  "$regexp = shift;"  saves
       the first command line argument as the regexp to be used, leaving the
       rest of the command line arguments to be treated as files.
       "while (<>)"  loops over all the lines in all the files.  For each
       line, "print if /$regexp/;"  prints the line if the regexp matches the
       line.  In this line, both "print" and "/$regexp/" use the default vari-
       able $_ implicitly.
       With all of the regexps above, if the regexp matched anywhere in the
       string, it was considered a match.  Sometimes, however, we'd like to
       specify where in the string the regexp should try to match.  To do
       this, we would use the anchor metacharacters "^" and "$".  The anchor
       "^" means match at the beginning of the string and the anchor "$" means
       match at the end of the string, or before a newline at the end of the
       string.  Here is how they are used:
           "housekeeper" =~ /keeper/;    # matches
           "housekeeper" =~ /^keeper/;   # doesn't match
           "housekeeper" =~ /keeper$/;   # matches
           "housekeeper\n" =~ /keeper$/; # matches
       The second regexp doesn't match because "^" constrains "keeper" to
       match only at the beginning of the string, but "housekeeper" has keeper
       starting in the middle.  The third regexp does match, since the "$"
       constrains "keeper" to match only at the end of the string.
       When both "^" and "$" are used at the same time, the regexp has to
       match both the beginning and the end of the string, i.e., the regexp
       matches the whole string.  Consider
           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           ""       =~ /^$/;          # ^$ matches an empty string
       The first regexp doesn't match because the string has more to it than
       "keep".  Since the second regexp is exactly the string, it matches.
       Using both "^" and "$" in a regexp forces the complete string to match,
       so it gives you complete control over which strings match and which
       don't.  Suppose you are looking for a fellow named bert, off in a
       string by himself:
           "dogbert" =~ /bert/;   # matches, but not what you want
           "dilbert" =~ /^bert/;  # doesn't match, but ..
           "bertram" =~ /^bert/;  # matches, so still not good enough
           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect
       Of course, in the case of a literal string, one could just as easily
       use the string equivalence "$string eq 'bert'"  and it would be more
       efficient.   The  "^...$" regexp really becomes useful when we add in
       the more powerful regexp tools below.
       Using character classes
       Although one can already do quite a lot with the literal string regexps
       above, we've only scratched the surface of regular expression technol-
       ogy.  In this and subsequent sections we will introduce regexp concepts
       (and associated metacharacter notations) that will allow a regexp to
       not just represent a single character sequence, but a whole class of
       them.
       One such concept is that of a character class.  A character class
       allows a set of possible characters, rather than just a single charac-
       ter, to match at a particular point in a regexp.  Character classes are
       denoted by brackets "[...]", with the set of characters to be possibly
       matched inside.  Here are some examples:
           /cat/;       # matches 'cat'
           /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
           /item[0123456789]/;  # matches 'item0' or ... or 'item9'
           "abc" =~ /[cab]/;    # matches 'a'
       In the last statement, even though 'c' is the first character in the
       class, 'a' matches because the first character position in the string
       is the earliest point at which the regexp can match.
           /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                                # 'yes', 'Yes', 'YES', etc.
       This regexp displays a common task: perform a case-insensitive match.
       Perl provides away of avoiding all those brackets by simply appending
       an 'i' to the end of the match.  Then "/[yY][eE][sS]/;" can be rewrit-
       ten as "/yes/i;".  The 'i' stands for case-insensitive and is an exam-
       ple of a modifier of the matching operation.  We will meet other modi-
       fiers later in the tutorial.
       We saw in the section above that there were ordinary characters, which
       represented themselves, and special characters, which needed a back-
       slash "\" to represent themselves.  The same is true in a character
       class, but the sets of ordinary and special characters inside a charac-
       ter class are different than those outside a character class.  The spe-
       cial characters for a character class are "-]\^$".  "]" is special
       because it denotes the end of a character class.  "$" is special
       because it denotes a scalar variable.  "\" is special because it is
       used in escape sequences, just like above.  Here is how the special
       characters "]$\" are handled:
          /[\]c]def/; # matches ']def' or 'cdef'
          $x = 'bcr';
          /[$x]at/;   # matches 'bat', 'cat', or 'rat'
          /[\$x]at/;  # matches '$at' or 'xat'
          /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
       The last two are a little tricky.  in "[\$x]", the backslash protects
       the dollar sign, so the character class has two members "$" and "x".
       In "[\\$x]", the backslash is protected, so $x is treated as a variable
       and substituted in double quote fashion.
       The special character '-' acts as a range operator within character
       classes, so that a contiguous set of characters can be written as a
       range.  With ranges, the unwieldy "[0123456789]" and "[abc...xyz]"
       become the svelte "[0-9]" and "[a-z]".  Some examples are
           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a perl variable name
       If '-' is the first or last character in a character class, it is
       treated as an ordinary character; "[-ab]", "[ab-]" and "[a\-b]" are all
       equivalent.
       The special character "^" in the first position of a character class
       denotes a negated character class, which matches any character but
       those in the brackets.  Both "[...]" and "[^...]" must match a charac-
       ter, or the match fails.  Then
           /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                      # all other 'bat', 'cat, '0at', '%at', etc.
           /[^0-9]/;  # matches a non-numeric character
           /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary
       Now, even "[0-9]" can be a bother the write multiple times, so in the
       interest of saving keystrokes and making regexps more readable, Perl
       has several abbreviations for common character classes:
       o   \d is a digit and represents [0-9]
       o   \s is a whitespace character and represents [\ \t\r\n\f]
       o   \w is a word character (alphanumeric or _) and represents
           [0-9a-zA-Z_]
       o   \D is a negated \d; it represents any character but a digit [^0-9]
       o   \S is a negated \s; it represents any non-whitespace character
           [^\s]
       o   \W is a negated \w; it represents any non-word character [^\w]
       o   The period '.' matches any character but "\n"
       The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of
       character classes.  Here are some in use:
           /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
           /[\d\s]/;         # matches any digit or whitespace character
           /\w\W\w/;         # matches a word char, followed by a
                             # non-word char, followed by a word char
           /..rt/;           # matches any two chars, followed by 'rt'
           /end\./;          # matches 'end.'
           /end[.]/;         # same thing, matches 'end.'
       Because a period is a metacharacter, it needs to be escaped to match as
       an ordinary period. Because, for example, "\d" and "\w" are sets of
       characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
       "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think
       DeMorgan's laws.
       An anchor useful in basic regexps is the word anchor  "\b".  This
       matches a boundary between a word character and a non-word character
       "\w\W" or "\W\w":
           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string
       Note in the last example, the end of the string is considered a word
       boundary.
       You might wonder why '.' matches everything but "\n" - why not every
       character? The reason is that often one is matching against lines and
       would like to ignore the newline characters.  For instance, while the
       string "\n" represents one line, we would like to think of as empty.
       Then
           ""   =~ /^$/;    # matches
           "\n" =~ /^$/;    # matches, "\n" is ignored
           ""   =~ /./;      # doesn't match; it needs a char
           ""   =~ /^.$/;    # doesn't match; it needs a char
           "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, ignores the "\n"
       This behavior is convenient, because we usually want to ignore newlines
       when we count and match characters in a line.  Sometimes, however, we
       want to keep track of newlines.  We might even want "^" and "$" to
       anchor at the beginning and end of lines within the string, rather than
       just the beginning and end of the string.  Perl allows us to choose
       between ignoring and paying attention to newlines by using the "//s"
       and "//m" modifiers.  "//s" and "//m" stand for single line and multi-
       line and they determine whether a string is to be treated as one con-
       tinuous string, or as a set of lines.  The two modifiers affect two
       aspects of how the regexp is interpreted: 1) how the '.' character
       class is defined, and 2) where the anchors "^" and "$" are able to
       match.  Here are the four possible combinations:
       o   no modifiers (//): Default behavior.  '.' matches any character
           except "\n".  "^" matches only at the beginning of the string and
           "$" matches only at the end or before a newline at the end.
       o   s modifier (//s): Treat string as a single long line.  '.' matches
           any character, even "\n".  "^" matches only at the beginning of the
           string and "$" matches only at the end or before a newline at the
           end.
       o   m modifier (//m): Treat string as a set of multiple lines.  '.'
           matches any character except "\n".  "^" and "$" are able to match
           at the start or end of any line within the string.
       o   both s and m modifiers (//sm): Treat string as a single long line,
           but detect multiple lines.  '.' matches any character, even "\n".
           "^" and "$", however, are able to match at the start or end of any
           line within the string.
       Here are examples of "//s" and "//m" in action:
           $x = "There once was a girl\nWho programmed in Perl\n";
           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line
           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/sm; # matches, "." matches "\n"
       Most of the time, the default behavior is what is want, but "//s" and
       "//m" are occasionally very useful.  If "//m" is being used, the start
       of the string can still be matched with "\A" and the end of string can
       still be matched with the anchors "\Z" (matches both the end and the
       newline before, like "$"), and "\z" (matches only the end):
           $x =~ /^Who/m;   # matches, "Who" at start of second line
           $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string
           $x =~ /girl$/m;  # matches, "girl" at end of first line
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
       We now know how to create choices among classes of characters in a reg-
       exp.  What about choices among words or character strings? Such choices
       are described in the next section.
       Matching this or that
       Sometimes we would like to our regexp to be able to match different
       possible words or character strings.  This is accomplished by using the
       alternation metacharacter "|".  To match "dog" or "cat", we form the
       regexp "dog|cat".  As before, perl will try to match the regexp at the
       earliest possible point in the string.  At each character position,
       perl will first try to match the first alternative, "dog".  If "dog"
       doesn't match, perl will then try the next alternative, "cat".  If
       "cat" doesn't match either, then the match fails and perl moves to the
       next position in the string.  Some examples:
           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"
       Even though "dog" is the first alternative in the second regexp, "cat"
       is able to match earlier in the string.
           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"
       Here, all the alternatives match at the first string position, so the
       first alternative is the one that matches.  If some of the alternatives
       are truncations of the others, put the longest ones first to give them
       a chance to match.
           "cab" =~ /a|b|c/ # matches "c"
                            # /a|b|c/ == /[abc]/
       The last example points out that character classes are like alterna-
       tions of characters.  At a given character position, the first alterna-
       tive that allows the regexp match to succeed will be the one that
       matches.
       Grouping things and hierarchical matching
       Alternation allows a regexp to choose among alternatives, but by itself
       it unsatisfying.  The reason is that each alternative is a whole reg-
       exp, but sometime we want alternatives for just part of a regexp.  For
       instance, suppose we want to search for housecats or housekeepers.  The
       regexp "housecat|housekeeper" fits the bill, but is inefficient because
       we had to type "house" twice.  It would be nice to have parts of the
       regexp be constant, like "house", and some parts have alternatives,
       like "cat|keeper".
       The grouping metacharacters "()" solve this problem.  Grouping allows
       parts of a regexp to be treated as a single unit.  Parts of a regexp
       are grouped by enclosing them in parentheses.  Thus we could solve the
       "housecat|housekeeper" by forming the regexp as "house(cat|keeper)".
       The regexp "house(cat|keeper)" means match "house" followed by either
       "cat" or "keeper".  Some more examples are
           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.
           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match
       Alternations behave the same way in groups as out of them: at a given
       string position, the leftmost alternative that allows the regexp to
       match is taken.  So in the last example at the first string position,
       "20" matches the second alternative, but there is nothing left over to
       match the next two digits "\d\d".  So perl moves on to the next alter-
       native, which is the null alternative and that works, since "20" is two
       digits.
       The process of trying one alternative, seeing if it matches, and moving
       on to the next alternative if it doesn't, is called backtracking.  The
       term 'backtracking' comes from the idea that matching a regexp is like
       a walk in the woods.  Successfully matching a regexp is like arriving
       at a destination.  There are many possible trailheads, one for each
       string position, and each one is tried in order, left to right.  From
       each trailhead there may be many paths, some of which get you there,
       and some which are dead ends.  When you walk along a trail and hit a
       dead end, you have to backtrack along the trail to an earlier point to
       try another trail.  If you hit your destination, you stop immediately
       and forget about trying all the other trails.  You are persistent, and
       only if you have tried all the trails from all the trailheads and not
       arrived at your destination, do you declare failure.  To be concrete,
       here is a step-by-step analysis of what perl does when it tries to
       match the regexp
           "abcde" =~ /(abd|abc)(df|d|de)/;
       0   Start with the first letter in the string 'a'.
       1   Try the first alternative in the first group 'abd'.
       2   Match 'a' followed by 'b'. So far so good.
       3   'd' in the regexp doesn't match 'c' in the string - a dead end.  So
           backtrack two characters and pick the second alternative in the
           first group 'abc'.
       4   Match 'a' followed by 'b' followed by 'c'.  We are on a roll and
           have satisfied the first group. Set $1 to 'abc'.
       5   Move on to the second group and pick the first alternative 'df'.
       6   Match the 'd'.
       7   'f' in the regexp doesn't match 'e' in the string, so a dead end.
           Backtrack one character and pick the second alternative in the sec-
           ond group 'd'.
       8   'd' matches. The second grouping is satisfied, so set $2 to 'd'.
       9   We are at the end of the regexp, so we are done! We have matched
           'abcd' out of the string "abcde".
       There are a couple of things to note about this analysis.  First, the
       third alternative in the second group 'de' also allows a match, but we
       stopped before we got to it - at a given character position, leftmost
       wins.  Second, we were able to get a match at the first character posi-
       tion of the string 'a'.  If there were no matches at the first posi-
       tion, perl would move to the second character position 'b' and attempt
       the match all over again.  Only when all possible paths at all possible
       character positions have been exhausted does perl give up and declare
       "$string =~ /(abd|abc)(df|d|de)/;"  to be false.
       Even with all this work, regexp matching happens remarkably fast.  To
       speed things up, during compilation stage, perl compiles the regexp
       into a compact sequence of opcodes that can often fit inside a proces-
       sor cache.  When the code is executed, these opcodes can then run at
       full throttle and search very quickly.
       Extracting matches
       The grouping metacharacters "()" also serve another completely differ-
       ent function: they allow the extraction of the parts of a string that
       matched.  This is very useful to find out what matched and for text
       processing in general.  For each grouping, the part that matched inside
       goes into the special variables $1, $2, etc.  They can be used just as
       ordinary variables:
           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }
       Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/"
       returns a true or false value.  In list context, however, it returns
       the list of matched values "($1,$2,$3)".  So we could write the code
       more compactly as
           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
       If the groupings in a regexp are nested, $1 gets the group with the
       leftmost opening parenthesis, $2 the next opening parenthesis, etc.
       For example, here is a complex regexp and the matching variables indi-
       cated below it:
           /(ab(cd|ef)((gi)|j))/;
            1  2      34
       so that if the regexp matched, e.g., $2 would contain 'cd' or 'ef'. For
       convenience, perl sets $+ to the string held by the highest numbered
       $1, $2, ... that got assigned (and, somewhat related, $^N to the value
       of the $1, $2, ... most-recently assigned; i.e. the $1, $2, ...
       associated with the rightmost closing parenthesis used in the match).
       Closely associated with the matching variables $1, $2, ... are the
       backreferences "\1", "\2", ... .  Backreferences are simply matching
       variables that can be used inside a regexp.  This is a really nice fea-
       ture - what matches later in a regexp can depend on what matched ear-
       lier in the regexp.  Suppose we wanted to look for doubled words in
       text, like 'the the'.  The following regexp finds all 3-letter doubles
       with a space in between:
           /(\w\w\w)\s\1/;
       The grouping assigns a value to \1, so that the same 3 letter sequence
       is used for both parts.  Here are some words with repeated parts:
           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa
       The regexp has a single grouping which considers 4-letter combinations,
       then 3-letter combinations, etc.  and uses "\1" to look for a repeat.
       Although $1 and "\1" represent the same thing, care should be taken to
       use matched variables $1, $2, ... only outside a regexp and backrefer-
       ences "\1", "\2", ... only inside a regexp; not doing so may lead to
       surprising and/or undefined results.
       In addition to what was matched, Perl 5.6.0 also provides the positions
       of what was matched with the "@-" and "@+" arrays. "$-[0]" is the posi-
       tion of the start of the entire match and $+[0] is the position of the
       end. Similarly, "$-[n]" is the position of the start of the $n match
       and $+[n] is the position of the end. If $n is undefined, so are
       "$-[n]" and $+[n]. Then this code
           $x = "Mmm...donut, thought Homer";
           $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
           foreach $expr (1..$#-) {
               print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
           }
       prints
           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)
       Even if there are no groupings in a regexp, it is still possible to
       find out what exactly matched in a string.  If you use them, perl will
       set $` to the part of the string before the match, will set $& to the
       part of the string that matched, and will set $' to the part of the
       string after the match.  An example:
           $x = "the cat caught the mouse";
           $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
           $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'
       In the second match, "$` = ''"  because the regexp matched at the first
       character position in the string and stopped, it never saw the second
       'the'.  It is important to note that using $` and $' slows down regexp
       matching quite a bit, and  $&  slows it down to a lesser extent,
       because if they are used in one regexp in a program, they are generated
       for <all> regexps in the program.  So if raw performance is a goal of
       your application, they should be avoided.  If you need them, use "@-"
       and "@+" instead:
           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )
       Matching repetitions
       The examples in the previous section display an annoying weakness.  We
       were only matching 3-letter words, or syllables of 4 letters or less.
       We'd like to be able to match words or syllables of any length, without
       writing out tedious alternatives like "\w\w\w\w|\w\w\w|\w\w|\w".
       This is exactly the problem the quantifier metacharacters "?", "*",
       "+", and "{}" were created for.  They allow us to determine the number
       of repeats of a portion of a regexp we consider to be a match.  Quanti-
       fiers are put immediately after the character, character class, or
       grouping that we want to specify.  They have the following meanings:
       o   "a?" = match 'a' 1 or 0 times
       o   "a*" = match 'a' 0 or more times, i.e., any number of times
       o   "a+" = match 'a' 1 or more times, i.e., at least once
       o   "a{n,m}" = match at least "n" times, but not more than "m" times.
       o   "a{n,}" = match at least "n" or more times
       o   "a{n}" = match exactly "n" times
       Here are some examples:
           /[a-z]+\s+\d*/;  # match a lowercase word, at least some space, and
                            # any number of digits
           /(\w+)\s+\1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /\d{2,4}/;  # make sure year is at least 2 but not more
                                # than 4 digits
           $year =~ /\d{4}|\d{2}/;    # better match; throw out 3 digit dates
           $year =~ /\d{2}(\d{2})?/;  # same thing written differently. However,
                                      # this produces $1 and the other does not.
           % simple_grep '^(\w+)\1$' /usr/dict/words   # isn't this easier?
           beriberi
           booboo
           coco
           mama
           murmur
           papa
       For all of these quantifiers, perl will try to match as much of the
       string as possible, while still allowing the regexp to succeed.  Thus
       with "/a?.../", perl will first try to match the regexp with the "a"
       present; if that fails, perl will try to match the regexp without the
       "a" present.  For the quantifier "*", we get the following:
           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'
       Which is what we might expect, the match finds the only "cat" in the
       string and locks onto it.  Consider, however, this regexp:
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)
       One might initially guess that perl would find the "at" in "cat" and
       stop there, but that wouldn't give the longest possible string to the
       first quantifier ".*".  Instead, the first quantifier ".*" grabs as
       much of the string as possible while still having the regexp match.  In
       this example, that means having the "at" sequence with the final "at"
       in the string.  The other important principle illustrated here is that
       when there are two or more elements in a regexp, the leftmost quanti-
       fier, if there is one, gets to grab as much the string as possible,
       leaving the rest of the regexp to fight over scraps.  Thus in our exam-
       ple, the first quantifier ".*" grabs most of the string, while the sec-
       ond quantifier ".*" gets the empty string.   Quantifiers that grab as
       much of the string as possible are called maximal match or greedy quan-
       tifiers.
       When a regexp can match a string in several different ways, we can use
       the principles above to predict which way the regexp will match:
       o   Principle 0: Taken as a whole, any regexp will be matched at the
           earliest possible position in the string.
       o   Principle 1: In an alternation "a|b|c...", the leftmost alternative
           that allows a match for the whole regexp will be the one used.
       o   Principle 2: The maximal matching quantifiers "?", "*", "+" and
           "{n,m}" will in general match as much of the string as possible
           while still allowing the whole regexp to match.
       o   Principle 3: If there are two or more elements in a regexp, the
           leftmost greedy quantifier, if any, will match as much of the
           string as possible while still allowing the whole regexp to match.
           The next leftmost greedy quantifier, if any, will try to match as
           much of the string remaining available to it as possible, while
           still allowing the whole regexp to match.  And so on, until all the
           regexp elements are satisfied.
       As we have seen above, Principle 0 overrides the others - the regexp
       will be matched as early as possible, with the other principles deter-
       mining how the regexp matches at that earliest character position.
       Here is an example of these principles in action:
           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'
       This regexp matches at the earliest string position, 'T'.  One might
       think that "e", being leftmost in the alternation, would be matched,
       but "r" produces the longest string in the first quantifier.
           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'
       Here, The earliest possible match is at the first 'm' in "programming".
       "m{1,2}" is the first quantifier, so it gets to match a maximal "mm".
           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'
       Here, the regexp matches at the start of the string. The first quanti-
       fier ".*" grabs as much as possible, leaving just a single 'm' for the
       second quantifier "m{1,2}".
           $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                       # $1 = 'a'
                                       # $2 = 'mm'
                                       # $3 = 'ing republic of Perl'
       Here, ".?" eats its maximal one character at the earliest possible
       position in the string, 'a' in "programming", leaving "m{1,2}" the
       opportunity to match both "m"'s. Finally,
           "aXXXb" =~ /(X*)/; # matches with $1 = ''
       because it can match zero copies of 'X' at the beginning of the string.
       If you definitely want to match at least one 'X', use "X+", not "X*".
       Sometimes greed is not good.  At times, we would like quantifiers to
       match a minimal piece of string, rather than a maximal piece.  For this
       purpose, Larry Wall created the minimal match  or non-greedy quanti-
       fiers "??","*?", "+?", and "{}?".  These are the usual quantifiers with
       a "?" appended to them.  They have the following meanings:
       o   "a??" = match 'a' 0 or 1 times. Try 0 first, then 1.
       o   "a*?" = match 'a' 0 or more times, i.e., any number of times, but
           as few times as possible
       o   "a+?" = match 'a' 1 or more times, i.e., at least once, but as few
           times as possible
       o   "a{n,m}?" = match at least "n" times, not more than "m" times, as
           few times as possible
       o   "a{n,}?" = match at least "n" times, but as few times as possible
       o   "a{n}?" = match exactly "n" times.  Because we match exactly "n"
           times, "a{n}?" is equivalent to "a{n}" and is just there for nota-
           tional consistency.
       Let's look at the example above, but with minimal quantifiers:
           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'
       The minimal string that will allow both the start of the string "^" and
       the alternation to match is "Th", with the alternation "e|r" matching
       "e".  The second quantifier ".*" is free to gobble up the rest of the
       string.
           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'
       The first string position that this regexp can match is at the first
       'm' in "programming". At this position, the minimal "m{1,2}?"  matches
       just one 'm'.  Although the second quantifier ".*?" would prefer to
       match no characters, it is constrained by the end-of-string anchor "$"
       to match the rest of the string.
           $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                         # $1 = 'The progra'
                                         # $2 = 'm'
                                         # $3 = 'ming republic of Perl'
       In this regexp, you might expect the first minimal quantifier ".*?"  to
       match the empty string, because it is not constrained by a "^" anchor
       to match the beginning of the word.  Principle 0 applies here, however.
       Because it is possible for the whole regexp to match at the start of
       the string, it will match at the start of the string.  Thus the first
       quantifier has to match everything up to the first "m".  The second
       minimal quantifier matches just one "m" and the third quantifier
       matches the rest of the string.
           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'
                                        # $2 = 'mm'
                                        # $3 = 'ing republic of Perl'
       Just as in the previous regexp, the first quantifier ".??" can match
       earliest at position 'a', so it does.  The second quantifier is greedy,
       so it matches "mm", and the third matches the rest of the string.
       We can modify principle 3 above to take into account non-greedy quanti-
       fiers:
       o   Principle 3: If there are two or more elements in a regexp, the
           leftmost greedy (non-greedy) quantifier, if any, will match as much
           (little) of the string as possible while still allowing the whole
           regexp to match.  The next leftmost greedy (non-greedy) quantifier,
           if any, will try to match as much (little) of the string remaining
           available to it as possible, while still allowing the whole regexp
           to match.  And so on, until all the regexp elements are satisfied.
       Just like alternation, quantifiers are also susceptible to backtrack-
       ing.  Here is a step-by-step analysis of the example
           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)
       0   Start with the first letter in the string 't'.
       1   The first quantifier '.*' starts out by matching the whole string
           'the cat in the hat'.
       2   'a' in the regexp element 'at' doesn't match the end of the string.
           Backtrack one character.
       3   'a' in the regexp element 'at' still doesn't match the last letter
           of the string 't', so backtrack one more character.
       4   Now we can match the 'a' and the 't'.
       5   Move on to the third element '.*'.  Since we are at the end of the
           string and '.*' can match 0 times, assign it the empty string.
       6   We are done!
       Most of the time, all this moving forward and backtracking happens
       quickly and searching is fast.   There are some pathological regexps,
       however, whose execution time exponentially grows with the size of the
       string.  A typical structure that blows up in your face is of the form
           /(a|b+)*/;
       The problem is the nested indeterminate quantifiers.  There are many
       different ways of partitioning a string of length n between the "+" and
       "*": one repetition with "b+" of length n, two repetitions with the
       first "b+" length k and the second with length n-k, m repetitions whose
       bits add up to length n, etc.  In fact there are an exponential number
       of ways to partition a string as a function of length.  A regexp may
       get lucky and match early in the process, but if there is no match,
       perl will try every possibility before giving up.  So be careful with
       nested "*"'s, "{n,m}"'s, and "+"'s.  The book Mastering regular expres-
       sions by Jeffrey Friedl gives a wonderful discussion of this and other
       efficiency issues.
       Building a regexp
       At this point, we have all the basic regexp concepts covered, so let's
       give a more involved example of a regular expression.  We will build a
       regexp that matches numbers.
       The first task in building a regexp is to decide what we want to match
       and what we want to exclude.  In our case, we want to match both inte-
       gers and floating point numbers and we want to reject any string that
       isn't a number.
       The next task is to break the problem down into smaller problems that
       are easily converted into a regexp.
       The simplest case is integers.  These consist of a sequence of digits,
       with an optional sign in front.  The digits we can represent with "\d+"
       and the sign can be matched with "[+-]".  Thus the integer regexp is
           /[+-]?\d+/;  # matches integers
       A floating point number potentially has a sign, an integral part, a
       decimal point, a fractional part, and an exponent.  One or more of
       these parts is optional, so we need to check out the different possi-
       bilities.  Floating point numbers which are in proper form include
       123., 0.345, .34, -1e6, and 25.4E-72.  As with integers, the sign out
       front is completely optional and can be matched by "[+-]?".  We can see
       that if there is no exponent, floating point numbers must have a deci-
       mal point, otherwise they are integers.  We might be tempted to model
       these with "\d*\.\d*", but this would also match just a single decimal
       point, which is not a number.  So the three cases of floating point
       number sans exponent are
          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.
       These can be combined into a single regexp with a three-way alterna-
       tion:
          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent
       In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.
       If '\d+\.' were first, the regexp would happily match that and ignore
       the fractional part of the number.
       Now consider floating point numbers with exponents.  The key observa-
       tion here is that both integers and numbers with decimal points are
       allowed in front of an exponent.  Then exponents, like the overall
       sign, are independent of whether we are matching numbers with or with-
       out decimal points, and can be 'decoupled' from the mantissa.  The
       overall form of the regexp now becomes clear:
           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
       The exponent is an "e" or "E", followed by an integer.  So the exponent
       regexp is
          /[eE][+-]?\d+/;  # exponent
       Putting all the parts together, we get a regexp that matches numbers:
          /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!
       Long regexps like this may impress your friends, but can be hard to
       decipher.  In complex situations like this, the "//x" modifier for a
       match is invaluable.  It allows one to put nearly arbitrary whitespace
       and comments into a regexp without affecting their meaning.  Using it,
       we can rewrite our 'extended' regexp in the more pleasing form
          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;
       If whitespace is mostly irrelevant, how does one include space charac-
       ters in an extended regexp? The answer is to backslash it '\ '  or put
       it in a character class "[ ]" .  The same thing goes for pound signs,
       use "\#" or "[#]".  For instance, Perl allows a space between the sign
       and the mantissa/integer, and we could add this to our regexp as fol-
       lows:
          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;
       In this form, it is easier to see a way to simplify the alternation.
       Alternatives 1, 2, and 4 all start with "\d+", so it could be factored
       out:
          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;
       or written in the compact form,
           /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
       This is our final regexp.  To recap, we built a regexp by
       o   specifying the task in detail,
       o   breaking down the problem into smaller parts,
       o   translating the small parts into regexps,
       o   combining the regexps,
       o   and optimizing the final combined regexp.
       These are also the typical steps involved in writing a computer pro-
       gram.  This makes perfect sense, because regular expressions are essen-
       tially programs written a little computer language that specifies pat-
       terns.
       Using regular expressions in Perl
       The last topic of Part 1 briefly covers how regexps are used in Perl
       programs.  Where do they fit into Perl syntax?
       We have already introduced the matching operator in its default "/reg-
       exp/" and arbitrary delimiter "m!regexp!" forms.  We have used the
       binding operator "=~" and its negation "!~" to test for string matches.
       Associated with the matching operator, we have discussed the single
       line "//s", multi-line "//m", case-insensitive "//i" and extended "//x"
       modifiers.
       There are a few more things you might want to know about matching oper-
       ators.  First, we pointed out earlier that variables in regexps are
       substituted before the regexp is evaluated:
           $pattern = 'Seuss';
           while (<>) {
               print if /$pattern/;
           }
       This will print any lines containing the word "Seuss".  It is not as
       efficient as it could be, however, because perl has to re-evaluate
       $pattern each time through the loop.  If $pattern won't be changing
       over the lifetime of the script, we can add the "//o" modifier, which
       directs perl to only perform variable substitutions once:
           #!/usr/bin/perl
           #    Improved simple_grep
           $regexp = shift;
           while (<>) {
               print if /$regexp/o;  # a good deal faster
           }
       If you change $pattern after the first substitution happens, perl will
       ignore it.  If you don't want any substitutions at all, use the special
       delimiter "m''":
           @pattern = ('Seuss');
           while (<>) {
               print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
           }
       "m''" acts like single quotes on a regexp; all other "m" delimiters act
       like double quotes.  If the regexp evaluates to the empty string, the
       regexp in the last successful match is used instead.  So we have
           "dog" =~ /d/;  # 'd' matches
           "dogbert =~ //;  # this matches the 'd' regexp used before
       The final two modifiers "//g" and "//c" concern multiple matches.  The
       modifier "//g" stands for global matching and allows the matching oper-
       ator to match within a string as many times as possible.  In scalar
       context, successive invocations against a string will have `"//g" jump
       from match to match, keeping track of position in the string as it goes
       along.  You can get or set the position with the "pos()" function.
       The use of "//g" is shown in the following example.  Suppose we have a
       string that consists of words separated by spaces.  If we know how many
       words there are in advance, we could extract the words using groupings:
           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'
                                                  # $3 = 'house'
       But what if we had an indeterminate number of words? This is the sort
       of task "//g" was made for.  To extract all words, form the simple reg-
       exp "(\w+)" and loop over all matches with "/(\w+)/g":
           while ($x =~ /(\w+)/g) {
               print "Word is $1, ends at position ", pos $x, "\n";
           }
       prints
           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13
       A failed match or changing the target string resets the position.  If
       you don't want the position reset after failure to match, add the
       "//c", as in "/regexp/gc".  The current position in the string is asso-
       ciated with the string, not the regexp.  This means that different
       strings have different positions and their respective positions can be
       set or read independently.
       In list context, "//g" returns a list of matched groupings, or if there
       are no groupings, a list of matches to the whole regexp.  So if we
       wanted just the words, we could use
           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $word[0] = 'cat'
                                       # $word[1] = 'dog'
                                       # $word[2] = 'house'
       Closely associated with the "//g" modifier is the "\G" anchor.  The
       "\G" anchor matches at the point where the previous "//g" match left
       off.  "\G" allows us to easily do context-sensitive matching:
           $metric = 1;  # use metric units
           ...
           $x = <FILE>;  # read in measurement
           $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
           $weight = $1;
           if ($metric) { # error checking
               print "Units error!" unless $x =~ /\Gkg\./g;
           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing
       The combination of "//g" and "\G" allows us to process the string a bit
       at a time and use arbitrary Perl logic to decide what to do next.  Cur-
       rently, the "\G" anchor is only fully supported when used to anchor to
       the start of the pattern.
       "\G" is also invaluable in processing fixed length records with reg-
       exps.  Suppose we have a snippet of coding region DNA, encoded as base
       pair letters "ATCGTTGAAT..." and we want to find all the stop codons
       "TGA".  In a coding region, codons are 3-letter sequences, so we can
       think of the DNA snippet as a sequence of 3-letter records.  The naive
       regexp
           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;
       doesn't work; it may match a "TGA", but there is no guarantee that the
       match is aligned with codon boundaries, e.g., the substring "GTT GAA"
       gives a match.  A better solution is
           while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }
       which prints
           Got a TGA stop codon at position 18
           Got a TGA stop codon at position 23
       Position 18 is good, but position 23 is bogus.  What happened?
       The answer is that our regexp works well until we get past the last
       real match.  Then the regexp will fail to match a synchronized "TGA"
       and start stepping ahead one character position at a time, not what we
       want.  The solution is to use "\G" to anchor the match to the codon
       alignment:
           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }
       This prints
           Got a TGA stop codon at position 18
       which is the correct answer.  This example illustrates that it is
       important not only to match what is desired, but to reject what is not
       desired.
       search and replace
       Regular expressions also play a big role in search and replace opera-
       tions in Perl.  Search and replace is accomplished with the "s///"
       operator.  The general form is "s/regexp/replacement/modifiers", with
       everything we know about regexps and modifiers applying in this case as
       well.  The "replacement" is a Perl double quoted string that replaces
       in the string whatever is matched with the "regexp".  The operator "=~"
       is also used here to associate a string with "s///".  If matching
       against $_, the "$_ =~"  can be dropped.  If there is a match, "s///"
       returns the number of substitutions made, otherwise it returns false.
       Here are a few examples:
           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"
       In the last example, the whole string was matched, but only the part
       inside the single quotes was grouped.  With the "s///" operator, the
       matched variables $1, $2, etc.  are immediately available for use in
       the replacement expression, so we use $1 to replace the quoted string
       with just what was quoted.  With the global modifier, "s///g" will
       search and replace all occurrences of the regexp in the string:
           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
                              # $x contains "I batted four for four"
       If you prefer 'regex' over 'regexp' in this tutorial, you could use the
       following program to replace it:
           % cat > simple_replace
           #!/usr/bin/perl
           $regexp = shift;
           $replacement = shift;
           while (<>) {
               s/$regexp/$replacement/go;
               print;
           }
           ^D
           % simple_replace regexp regex perlretut.pod
       In "simple_replace" we used the "s///g" modifier to replace all occur-
       rences of the regexp on each line and the "s///o" modifier to compile
       the regexp only once.  As with "simple_grep", both the "print" and the
       "s/$regexp/$replacement/go" use $_ implicitly.
       A modifier available specifically to search and replace is the "s///e"
       evaluation modifier.  "s///e" wraps an "eval{...}" around the replace-
       ment string and the evaluated result is substituted for the matched
       substring.  "s///e" is useful if you need to do a bit of computation in
       the process of replacing text.  This example counts character frequen-
       cies in a line:
           $x = "Bill the cat";
           $x =~ s/(.)/$chars{$1}++;$1/eg;  # final $1 replaces char with itself
           print "frequency of '$_' is $chars{$_}\n"
               foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
       This prints
           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1
       As with the match "m//" operator, "s///" can use other delimiters, such
       as "s!!!" and "s{}{}", and even "s{}//".  If single quotes are used
       "s'''", then the regexp and replacement are treated as single quoted
       strings and there are no substitutions.  "s///" in list context returns
       the same thing as in scalar context, i.e., the number of matches.
       The split operator
       The "split"  function can also optionally use a matching operator "m//"
       to split a string.  "split /regexp/, string, limit" splits "string"
       into a list of substrings and returns that list.  The regexp is used to
       match the character sequence that the "string" is split with respect
       to.  The "limit", if present, constrains splitting into no more than
       "limit" number of strings.  For example, to split a string into words,
       use
           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'
       If the empty regexp "//" is used, the regexp always matches and the
       string is split into individual characters.  If the regexp has group-
       ings, then list produced contains the matched substrings from the
       groupings as well.  For instance,
           $x = "/usr/bin/perl";
           @dirs = split m!/!, $x;  # $dirs[0] = ''
                                    # $dirs[1] = 'usr'
                                    # $dirs[2] = 'bin'
                                    # $dirs[3] = 'perl'
           @parts = split m!(/)!, $x;  # $parts[0] = ''
                                       # $parts[1] = '/'
                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'
                                       # $parts[4] = 'bin'
                                       # $parts[5] = '/'
                                       # $parts[6] = 'perl'
       Since the first character of $x matched the regexp, "split" prepended
       an empty initial element to the list.
       If you have read this far, congratulations! You now have all the basic
       tools needed to use regular expressions to solve a wide range of text
       processing problems.  If this is your first time through the tutorial,
       why not stop here and play around with regexps a while...  Part 2 con-
       cerns the more esoteric aspects of regular expressions and those con-
       cepts certainly aren't needed right at the start.
Part 2: Power tools
       OK, you know the basics of regexps and you want to know more.  If
       matching regular expressions is analogous to a walk in the woods, then
       the tools discussed in Part 1 are analogous to topo maps and a compass,
       basic tools we use all the time.  Most of the tools in part 2 are anal-
       ogous to flare guns and satellite phones.  They aren't used too often
       on a hike, but when we are stuck, they can be invaluable.
       What follows are the more advanced, less used, or sometimes esoteric
       capabilities of perl regexps.  In Part 2, we will assume you are com-
       fortable with the basics and concentrate on the new features.
       More on characters, strings, and character classes
       There are a number of escape sequences and character classes that we
       haven't covered yet.
       There are several escape sequences that convert characters or strings
       between upper and lower case.  "\l" and "\u" convert the next character
       to lower or upper case, respectively:
           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',
       "\L" and "\U" converts a whole substring, delimited by "\L" or "\U" and
       "\E", to lower or upper case:
           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360"
           $x =~ /\Ukeypunch/;  # matches punch card string
       If there is no "\E", case is converted until the end of the string. The
       regexps "\L\u$word" or "\u\L$word" convert the first character of $word
       to uppercase and the rest of the characters to lowercase.
       Control characters can be escaped with "\c", so that a control-Z char-
       acter would be matched with "\cZ".  The escape sequence "\Q"..."\E"
       quotes, or protects most non-alphabetic characters.   For instance,
           $x = "\QThat !^*&%~& cat!";
           $x =~ /\Q!^*&%~&\E/;  # check for rough language
       It does not protect "$" or "@", so that variables can still be substi-
       tuted.
       With the advent of 5.6.0, perl regexps can handle more than just the
       standard ASCII character set.  Perl now supports Unicode, a standard
       for encoding the character sets from many of the world's written lan-
       guages.  Unicode does this by allowing characters to be more than one
       byte wide.  Perl uses the UTF-8 encoding, in which ASCII characters are
       still encoded as one byte, but characters greater than "chr(127)" may
       be stored as two or more bytes.
       What does this mean for regexps? Well, regexp users don't need to know
       much about perl's internal representation of strings.  But they do need
       to know 1) how to represent Unicode characters in a regexp and 2) when
       a matching operation will treat the string to be searched as a sequence
       of bytes (the old way) or as a sequence of Unicode characters (the new
       way).  The answer to 1) is that Unicode characters greater than
       "chr(127)" may be represented using the "\x{hex}" notation, with "hex"
       a hexadecimal integer:
           /\x{263a}/;  # match a Unicode smiley face :)
       Unicode characters in the range of 128-255 use two hexadecimal digits
       with braces: "\x{ab}".  Note that this is different than "\xab", which
       is just a hexadecimal byte with no Unicode significance.
       NOTE: in Perl 5.6.0 it used to be that one needed to say "use utf8" to
       use any Unicode features.  This is no more the case: for almost all
       Unicode processing, the explicit "utf8" pragma is not needed.  (The
       only case where it matters is if your Perl script is in Unicode and
       encoded in UTF-8, then an explicit "use utf8" is needed.)
       Figuring out the hexadecimal sequence of a Unicode character you want
       or deciphering someone else's hexadecimal Unicode regexp is about as
       much fun as programming in machine code.  So another way to specify
       Unicode characters is to use the named character  escape sequence
       "\N{name}".  "name" is a name for the Unicode character, as specified
       in the Unicode standard.  For instance, if we wanted to represent or
       match the astrological sign for the planet Mercury, we could use
           use charnames ":full"; # use named chars with Unicode full names
           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches
       One can also use short names or restrict names to a certain alphabet:
           use charnames ':full';
           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
           use charnames ":short";
           print "\N{greek:Sigma} is an upper-case sigma.\n";
           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";
       A list of full names is found in the file Names.txt in the
       lib/perl5/5.X.X/unicore directory.
       The answer to requirement 2), as of 5.6.0, is that if a regexp contains
       Unicode characters, the string is searched as a sequence of Unicode
       characters.  Otherwise, the string is searched as a sequence of bytes.
       If the string is being searched as a sequence of Unicode characters,
       but matching a single byte is required, we can use the "\C" escape
       sequence.  "\C" is a character class akin to "." except that it matches
       any byte 0-255.  So
           use charnames ":full"; # use named chars with Unicode full names
           $x = "a";
           $x =~ /\C/;  # matches 'a', eats one byte
           $x = "";
           $x =~ /\C/;  # doesn't match, no bytes to match
           $x = "\N{MERCURY}";  # two-byte Unicode character
           $x =~ /\C/;  # matches, but dangerous!
       The last regexp matches, but is dangerous because the string character
       position is no longer synchronized to the string byte position.  This
       generates the warning 'Malformed UTF-8 character'.  The "\C" is best
       used for matching the binary data in strings with binary data inter-
       mixed with Unicode characters.
       Let us now discuss the rest of the character classes.  Just as with
       Unicode characters, there are named Unicode character classes repre-
       sented by the "\p{name}" escape sequence.  Closely associated is the
       "\P{name}" character class, which is the negation of the "\p{name}"
       class.  For example, to match lower and uppercase characters,
           use charnames ":full"; # use named chars with Unicode full names
           $x = "BOB";
           $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
           $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
           $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase
       Here is the association between some Perl named classes and the tradi-
       tional Unicode classes:
           Perl class name  Unicode class name or regular expression
           IsAlpha          /^[LM]/
           IsAlnum          /^[LMN]/
           IsASCII          $code <= 127
           IsCntrl          /^C/
           IsBlank          $code =~ /^(0020|0009)$/ || /^Z[^lp]/
           IsDigit          Nd
           IsGraph          /^([LMNPS]|Co)/
           IsLower          Ll
           IsPrint          /^([LMNPS]|Co|Zs)/
           IsPunct          /^P/
           IsSpace          /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
           IsSpacePerl      /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
           IsUpper          /^L[ut]/
           IsWord           /^[LMN]/ || $code eq "005F"
           IsXDigit         $code =~ /^00(3[0-9]|[46][1-6])$/
       You can also use the official Unicode class names with the "\p" and
       "\P", like "\p{L}" for Unicode 'letters', or "\p{Lu}" for uppercase
       letters, or "\P{Nd}" for non-digits.  If a "name" is just one letter,
       the braces can be dropped.  For instance, "\pM" is the character class
       of Unicode 'marks', for example accent marks.  For the full list see
       perlunicode.
       The Unicode has also been separated into various sets of characters
       which you can test with "\p{In...}" (in) and "\P{In...}" (not in), for
       example "\p{Latin}", "\p{Greek}", or "\P{Katakana}".  For the full list
       see perlunicode.
       "\X" is an abbreviation for a character class sequence that includes
       the Unicode 'combining character sequences'.  A 'combining character
       sequence' is a base character followed by any number of combining char-
       acters.  An example of a combining character is an accent.   Using the
       Unicode full names, e.g., "A + COMBINING RING"  is a combining charac-
       ter sequence with base character "A" and combining character "COMBIN-
       ING RING" , which translates in Danish to A with the circle atop it, as
       in the word Angstrom.  "\X" is equivalent to "\PM\pM*}", i.e., a non-
       mark followed by one or more marks.
       For the full and latest information about Unicode see the latest Uni-
       code standard, or the Unicode Consortium's website http://www.uni-
       code.org/
       As if all those classes weren't enough, Perl also defines POSIX style
       character classes.  These have the form "[:name:]", with "name" the
       name of the POSIX class.  The POSIX classes are "alpha", "alnum",
       "ascii", "cntrl", "digit", "graph", "lower", "print", "punct", "space",
       "upper", and "xdigit", and two extensions, "word" (a Perl extension to
       match "\w"), and "blank" (a GNU extension).  If "utf8" is being used,
       then these classes are defined the same as their corresponding perl
       Unicode classes: "[:upper:]" is the same as "\p{IsUpper}", etc.  The
       POSIX character classes, however, don't require using "utf8".  The
       "[:digit:]", "[:word:]", and "[:space:]" correspond to the familiar
       "\d", "\w", and "\s" character classes.  To negate a POSIX class, put a
       "^" in front of the name, so that, e.g., "[:^digit:]" corresponds to
       "\D" and under "utf8", "\P{IsDigit}".  The Unicode and POSIX character
       classes can be used just like "\d", with the exception that POSIX char-
       acter classes can only be used inside of a character class:
           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           use charnames ":full";
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit
       Whew! That is all the rest of the characters and character classes.
       Compiling and saving regular expressions
       In Part 1 we discussed the "//o" modifier, which compiles a regexp just
       once.  This suggests that a compiled regexp is some data structure that
       can be stored once and used again and again.  The regexp quote "qr//"
       does exactly that: "qr/string/" compiles the "string" as a regexp and
       transforms the result into a form that can be assigned to a variable:
           $reg = qr/foo+bar?/;  # reg contains a compiled regexp
       Then $reg can be used as a regexp:
           $x = "fooooba";
           $x =~ $reg;     # matches, just like /foo+bar?/
           $x =~ /$reg/;   # same thing, alternate form
       $reg can also be interpolated into a larger regexp:
           $x =~ /(abc)?$reg/;  # still matches
       As with the matching operator, the regexp quote can use different
       delimiters, e.g., "qr!!", "qr{}" and "qr~~".  The single quote delim-
       iters "qr''" prevent any interpolation from taking place.
       Pre-compiled regexps are useful for creating dynamic matches that don't
       need to be recompiled each time they are encountered.  Using pre-com-
       piled regexps, "simple_grep" program can be expanded into a program
       that matches multiple patterns:
           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               foreach $pattern (@compiled) {
                   if ($line =~ /$pattern/) {
                       print $line;
                       last;  # we matched, so move onto the next line
                   }
               }
           }
           ^D
           % multi_grep 2 last for multi_grep
               $regexp[$_] = shift foreach (0..$number-1);
                   foreach $pattern (@compiled) {
                           last;
       Storing pre-compiled regexps in an array @compiled allows us to simply
       loop through the regexps without any recompilation, thus gaining flexi-
       bility without sacrificing speed.
       Embedding comments and modifiers in a regular expression
       Starting with this section, we will be discussing Perl's set of
       extended patterns.  These are extensions to the traditional regular
       expression syntax that provide powerful new tools for pattern matching.
       We have already seen extensions in the form of the minimal matching
       constructs "??", "*?", "+?", "{n,m}?", and "{n,}?".  The rest of the
       extensions below have the form "(?char...)", where the "char" is a
       character that determines the type of extension.
       The first extension is an embedded comment "(?#text)".  This embeds a
       comment into the regular expression without affecting its meaning.  The
       comment should not have any closing parentheses in the text.  An exam-
       ple is
           /(?# Match an integer:)[+-]?\d+/;
       This style of commenting has been largely superseded by the raw,
       freeform commenting that is allowed with the "//x" modifier.
       The modifiers "//i", "//m", "//s", and "//x" can also embedded in a
       regexp using "(?i)", "(?m)", "(?s)", and "(?x)".  For instance,
           /(?i)yes/;  # match 'yes' case insensitively
           /yes/i;     # same thing
           /(?x)(          # freeform version of an integer regexp
                    [+-]?  # match an optional sign
                    \d+    # match a sequence of digits
                )
           /x;
       Embedded modifiers can have two important advantages over the usual
       modifiers.  Embedded modifiers allow a custom set of modifiers to each
       regexp pattern.  This is great for matching an array of regexps that
       must have different modifiers:
           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }
       The second advantage is that embedded modifiers only affect the regexp
       inside the group the embedded modifier is contained in.  So grouping
       can be used to localize the modifier's effects:
           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.
       Embedded modifiers can also turn off any modifiers already present by
       using, e.g., "(?-i)".  Modifiers can also be combined into a single
       expression, e.g., "(?s-i)" turns on single line mode and turns off case
       insensitivity.
       Non-capturing groupings
       We noted in Part 1 that groupings "()" had two distinct functions: 1)
       group regexp elements together as a single unit, and 2) extract, or
       capture, substrings that matched the regexp in the grouping.  Non-cap-
       turing groupings, denoted by "(?:regexp)", allow the regexp to be
       treated as a single unit, but don't extract substrings or set matching
       variables $1, etc.  Both capturing and non-capturing groupings are
       allowed to co-exist in the same regexp.  Because there is no extrac-
       tion, non-capturing groupings are faster than capturing groupings.
       Non-capturing groupings are also handy for choosing exactly which parts
       of a regexp are to be extracted to matching variables:
           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
           # match a number, get $1 = whole number, $2 = exponent
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
       Non-capturing groupings are also useful for removing nuisance elements
       gathered from a split operation:
           $x = '12a34b5';
           @num = split /(a|b)/, $x;    # @num = ('12','a','34','b','5')
           @num = split /(?:a|b)/, $x;  # @num = ('12','34','5')
       Non-capturing groupings may also have embedded modifiers:
       "(?i-m:regexp)" is a non-capturing grouping that matches "regexp" case
       insensitively and turns off multi-line mode.
       Looking ahead and looking behind
       This section concerns the lookahead and lookbehind assertions.  First,
       a little background.
       In Perl regular expressions, most regexp elements 'eat up' a certain
       amount of string when they match.  For instance, the regexp element
       "[abc}]" eats up one character of the string when it matches, in the
       sense that perl moves to the next character position in the string
       after the match.  There are some elements, however, that don't eat up
       characters (advance the character position) if they match.  The exam-
       ples we have seen so far are the anchors.  The anchor "^" matches the
       beginning of the line, but doesn't eat any characters.  Similarly, the
       word boundary anchor "\b" matches, e.g., if the character to the left
       is a word character and the character to the right is a non-word char-
       acter, but it doesn't eat up any characters itself.  Anchors are exam-
       ples of 'zero-width assertions'.  Zero-width, because they consume no
       characters, and assertions, because they test some property of the
       string.  In the context of our walk in the woods analogy to regexp
       matching, most regexp elements move us along a trail, but anchors have
       us stop a moment and check our surroundings.  If the local environment
       checks out, we can proceed forward.  But if the local environment
       doesn't satisfy us, we must backtrack.
       Checking the environment entails either looking ahead on the trail,
       looking behind, or both.  "^" looks behind, to see that there are no
       characters before.  "$" looks ahead, to see that there are no charac-
       ters after.  "\b" looks both ahead and behind, to see if the characters
       on either side differ in their 'word'-ness.
       The lookahead and lookbehind assertions are generalizations of the
       anchor concept.  Lookahead and lookbehind are zero-width assertions
       that let us specify which characters we want to test for.  The looka-
       head assertion is denoted by "(?=regexp)" and the lookbehind assertion
       is denoted by "(?<=fixed-regexp)".  Some examples are
           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(?=\s+)/;  # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x
       Note that the parentheses in "(?=regexp)" and "(?<=regexp)" are
       non-capturing, since these are zero-width assertions.  Thus in the sec-
       ond regexp, the substrings captured are those of the whole regexp
       itself.  Lookahead "(?=regexp)" can match arbitrary regexps, but look-
       behind "(?<=fixed-regexp)" only works for regexps of fixed width, i.e.,
       a fixed number of characters long.  Thus "(?<=(ab|bc))" is fine, but
       "(?<=(ab)*)" is not.  The negated versions of the lookahead and lookbe-
       hind assertions are denoted by "(?!regexp)" and "(?<!fixed-regexp)"
       respectively.  They evaluate true if the regexps do not match:
           $x = "foobar";
           $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
           $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
           $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'
       The "\C" is unsupported in lookbehind, because the already treacherous
       definition of "\C" would become even more so when going backwards.
       Using independent subexpressions to prevent backtracking
       The last few extended patterns in this tutorial are experimental as of
       5.6.0.  Play with them, use them in some code, but don't rely on them
       just yet for production code.
       Independent subexpressions  are regular expressions, in the context of
       a larger regular expression, that function independently of the larger
       regular expression.  That is, they consume as much or as little of the
       string as they wish without regard for the ability of the larger regexp
       to match.  Independent subexpressions are represented by "(?>regexp)".
       We can illustrate their behavior by first considering an ordinary reg-
       exp:
           $x = "ab";
           $x =~ /a*ab/;  # matches
       This obviously matches, but in the process of matching, the subexpres-
       sion "a*" first grabbed the "a".  Doing so, however, wouldn't allow the
       whole regexp to match, so after backtracking, "a*" eventually gave back
       the "a" and matched the empty string.  Here, what "a*" matched was
       dependent on what the rest of the regexp matched.
       Contrast that with an independent subexpression:
           $x =~ /(?>a*)ab/;  # doesn't match!
       The independent subexpression "(?>a*)" doesn't care about the rest of
       the regexp, so it sees an "a" and grabs it.  Then the rest of the reg-
       exp "ab" cannot match.  Because "(?>a*)" is independent, there is no
       backtracking and the independent subexpression does not give up its
       "a".  Thus the match of the regexp as a whole fails.  A similar behav-
       ior occurs with completely independent regexps:
           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available
       Here "//g" and "\G" create a 'tag team' handoff of the string from one
       regexp to the other.  Regexps with an independent subexpression are
       much like this, with a handoff of the string to the independent subex-
       pression, and a handoff of the string back to the enclosing regexp.
       The ability of an independent subexpression to prevent backtracking can
       be quite useful.  Suppose we want to match a non-empty string enclosed
       in parentheses up to two levels deep.  Then the following regexp
       matches:
           $x = "abc(de(fg)h";  # unbalanced parentheses
           $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
       The regexp matches an open parenthesis, one or more copies of an alter-
       nation, and a close parenthesis.  The alternation is two-way, with the
       first alternative "[^()]+" matching a substring with no parentheses and
       the second alternative "\([^()]*\)"  matching a substring delimited by
       parentheses.  The problem with this regexp is that it is pathological:
       it has nested indeterminate quantifiers of the form "(a+|b)+".  We dis-
       cussed in Part 1 how nested quantifiers like this could take an expo-
       nentially long time to execute if there was no match possible.  To pre-
       vent the exponential blowup, we need to prevent useless backtracking at
       some point.  This can be done by enclosing the inner quantifier as an
       independent subexpression:
           $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
       Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by
       gobbling up as much of the string as possible and keeping it.   Then
       match failures fail much more quickly.
       Conditional expressions
       A conditional expression  is a form of if-then-else statement that
       allows one to choose which patterns are to be matched, based on some
       condition.  There are two types of conditional expression: "(?(condi-
       tion)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)".  "(?(condi-
       tion)yes-regexp)" is like an 'if () {}'  statement in Perl.  If the
       "condition" is true, the "yes-regexp" will be matched.  If the "condi-
       tion" is false, the "yes-regexp" will be skipped and perl will move
       onto the next regexp element.  The second form is like an
       'if () {} else {}'  statement in Perl.  If the "condition" is true, the
       "yes-regexp" will be matched, otherwise the "no-regexp" will be
       matched.
       The "condition" can have two forms.  The first form is simply an inte-
       ger in parentheses "(integer)".  It is true if the corresponding back-
       reference "\integer" matched earlier in the regexp.  The second form is
       a bare zero width assertion "(?...)", either a lookahead, a lookbehind,
       or a code assertion (discussed in the next section).
       The integer form of the "condition" allows us to choose, with more
       flexibility, what to match based on what matched earlier in the regexp.
       This searches for words of the form "$x$x" or "$x$y$y$x":
           % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...
           toot
           toto
           tutu
       The lookbehind "condition" allows, along with backreferences, an ear-
       lier part of the match to influence a later part of the match.  For
       instance,
           /[ATGC]+(?(?<=AA)G|C)$/;
       matches a DNA sequence such that it either ends in "AAG", or some other
       base pair combination and "C".  Note that the form is "(?(?<=AA)G|C)"
       and not "(?((?<=AA))G|C)"; for the lookahead, lookbehind or code asser-
       tions, the parentheses around the conditional are not needed.
       A bit of magic: executing Perl code in a regular expression
       Normally, regexps are a part of Perl expressions.  Code evaluation
       expressions turn that around by allowing arbitrary Perl code to be a
       part of a regexp.  A code evaluation expression is denoted "(?{code})",
       with "code" a string of Perl statements.
       Code expressions are zero-width assertions, and the value they return
       depends on their environment.  There are two possibilities: either the
       code expression is used as a conditional in a conditional expression
       "(?(condition)...)", or it is not.  If the code expression is a condi-
       tional, the code is evaluated and the result (i.e., the result of the
       last statement) is used to determine truth or falsehood.  If the code
       expression is not used as a conditional, the assertion always evaluates
       true and the result is put into the special variable $^R.  The variable
       $^R can then be used in code expressions later in the regexp.  Here are
       some silly examples:
           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'
       Pay careful attention to the next example:
           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?
       At first glance, you'd think that it shouldn't print, because obviously
       the "ddd" isn't going to match the target string. But look at this
       example:
           $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
                                                  # but _does_ print
       Hmm. What happened here? If you've been following along, you know that
       the above pattern should be effectively the same as the last one --
       enclosing the d in a character class isn't going to change what it
       matches. So why does the first not print while the second one does?
       The answer lies in the optimizations the REx engine makes. In the first
       case, all the engine sees are plain old characters (aside from the
       "?{}" construct). It's smart enough to realize that the string 'ddd'
       doesn't occur in our target string before actually running the pattern
       through. But in the second case, we've tricked it into thinking that
       our pattern is more complicated than it is. It takes a look, sees our
       character class, and decides that it will have to actually run the pat-
       tern to determine whether or not it matches, and in the process of run-
       ning it hits the print statement before it discovers that we don't have
       a match.
       To take a closer look at how the engine does optimizations, see the
       section "Pragmas and debugging" below.
       More fun with "?{}":
           $x =~ /(?{print "Hi Mom!";})/;       # matches,
                                                # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'
       The bit of magic mentioned in the section title occurs when the regexp
       backtracks in the process of searching for a match.  If the regexp
       backtracks over a code expression and if the variables used within are
       localized using "local", the changes in the variables produced by the
       code expression are undone! Thus, if we wanted to count how many times
       a character got matched inside a group, we could use, e.g.,
           $x = "aaaa";
           $count = 0;  # initialize 'a' count
           $c = "bob";  # test if $c gets clobbered
           $x =~ /(?{local $c = 0;})         # initialize count
                  ( a                        # match 'a'
                    (?{local $c = $c + 1;})  # increment count
                  )*                         # do this any number of times,
                  aa                         # but match 'aa' at the end
                  (?{$count = $c;})          # copy local $c var into $count
                 /x;
           print "'a' count is $count, \$c variable is '$c'\n";
       This prints
           'a' count is 2, $c variable is 'bob'
       If we replace the " (?{local $c = $c + 1;})"  with
       " (?{$c = $c + 1;})" , the variable changes are not undone during back-
       tracking, and we get
           'a' count is 4, $c variable is 'bob'
       Note that only localized variable changes are undone.  Other side
       effects of code expression execution are permanent.  Thus
           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;
       produces
          Yow
          Yow
          Yow
          Yow
       The result $^R is automatically localized, so that it will behave prop-
       erly in the presence of backtracking.
       This example uses a code expression in a conditional to match the arti-
       cle 'the' in either English or German:
           $lang = 'DE';  # use German
           ...
           $text = "das";
           print "matched\n"
               if $text =~ /(?(?{
                                 $lang eq 'EN'; # is the language English?
                                })
                              the |             # if so, then match 'the'
                              (die|das|der)     # else, match 'die|das|der'
                            )
                           /xi;
       Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not
       "(?((?{...}))yes-regexp|no-regexp)".  In other words, in the case of a
       code expression, we don't need the extra parentheses around the condi-
       tional.
       If you try to use code expressions with interpolating variables, perl
       may surprise you:
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compile error!
           /foo${pat}bar/;      # compile error!
           $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
           /foo${pat}bar/;      # compiles ok
       If a regexp has (1) code expressions and interpolating variables, or
       (2) a variable that interpolates a code expression, perl treats the
       regexp as an error. If the code expression is precompiled into a vari-
       able, however, interpolating is ok. The question is, why is this an
       error?
       The reason is that variable interpolation and code expressions together
       pose a security risk.  The combination is dangerous because many
       programmers who write search engines often take user input and plug it
       directly into a regexp:
           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp
       If the $regexp variable contains a code expression, the user could then
       execute arbitrary Perl code.  For instance, some joker could search for
       "system('rm -rf *');"  to erase your files.  In this sense, the combi-
       nation of interpolation and code expressions taints your regexp.  So by
       default, using both interpolation and code expressions in the same reg-
       exp is not allowed.  If you're not concerned about malicious users, it
       is possible to bypass this security check by invoking "use re 'eval'" :
           use re 'eval';       # throw caution out the door
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ 1 })$bar/;   # compiles ok
           /foo${pat}bar/;      # compiles ok
       Another form of code expression is the pattern code expression .  The
       pattern code expression is like a regular code expression, except that
       the result of the code evaluation is treated as a regular expression
       and matched immediately.  A simple example is
           $length = 5;
           $char = 'a';
           $x = 'aaaaabb';
           $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
       This final example contains both ordinary and pattern code expressions.
       It detects if a binary string 1101010010001... has a Fibonacci spacing
       0,1,1,2,3,5,...  of the 1's:
           $s0 = 0; $s1 = 1; # initial conditions
           $x = "1101010010001000001";
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (
                              (??{'0' x $s0}) # match $s0 of '0'
                              1               # and then a '1'
                              (?{
                                 $largest = $s0;   # largest seq so far
                                 $s2 = $s1 + $s0;  # compute next term
                                 $s0 = $s1;        # in Fibonacci sequence
                                 $s1 = $s2;
                                })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           print "Largest sequence matched was $largest\n";
       This prints
           It is a Fibonacci sequence
           Largest sequence matched was 5
       Ha! Try that with your garden variety regexp package...
       Note that the variables $s0 and $s1 are not substituted when the regexp
       is compiled, as happens for ordinary variables outside a code expres-
       sion.  Rather, the code expressions are evaluated when perl encounters
       them during the search for a match.
       The regexp without the "//x" modifier is
           /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
       and is a great start on an Obfuscated Perl entry :-) When working with
       code and conditional expressions, the extended form of regexps is
       almost necessary in creating and debugging regexps.
       Pragmas and debugging
       Speaking of debugging, there are several pragmas available to control
       and debug regexps in Perl.  We have already encountered one pragma in
       the previous section, "use re 'eval';" , that allows variable interpo-
       lation and code expressions to coexist in a regexp.  The other pragmas
       are
           use re 'taint';
           $tainted = <>;
           @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
       The "taint" pragma causes any substrings from a match with a tainted
       variable to be tainted as well.  This is not normally the case, as reg-
       exps are often used to extract the safe bits from a tainted variable.
       Use "taint" when you are not extracting safe bits, but are performing
       some other processing.  Both "taint" and "eval" pragmas are lexically
       scoped, which means they are in effect only until the end of the block
       enclosing the pragmas.
           use re 'debug';
           /^(.*)$/s;       # output debugging info
           use re 'debugcolor';
           /^(.*)$/s;       # output debugging info in living color
       The global "debug" and "debugcolor" pragmas allow one to get detailed
       debugging info about regexp compilation and execution.  "debugcolor" is
       the same as debug, except the debugging information is displayed in
       color on terminals that can display termcap color sequences.  Here is
       example output:
           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx `a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
           floating `bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx `a*b+c' against `abc'...
           Found floating substr `bc' at offset 1...
           Guessed: match at offset 0
           Matching REx `a*b+c' against `abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>             |  1:  STAR
                                      EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>             |  4:    PLUS
                                      EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>             |  7:      EXACT <c>
              3 <abc> <>             |  9:      END
           Match successful!
           Freeing REx: `a*b+c'
       If you have gotten this far into the tutorial, you can probably guess
       what the different parts of the debugging output tell you.  The first
       part
           Compiling REx `a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
       describes the compilation stage.  STAR(4) means that there is a starred
       object, in this case 'a', and if it matches, goto line 4, i.e.,
       PLUS(7).  The middle lines describe some heuristics and optimizations
       performed before a match:
           floating `bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx `a*b+c' against `abc'...
           Found floating substr `bc' at offset 1...
           Guessed: match at offset 0
       Then the match is executed and the remaining lines describe the pro-
       cess:
           Matching REx `a*b+c' against `abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>             |  1:  STAR
                                      EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>             |  4:    PLUS
                                      EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>             |  7:      EXACT <c>
              3 <abc> <>             |  9:      END
           Match successful!
           Freeing REx: `a*b+c'
       Each step is of the form "n <x> <y>" , with "<x>" the part of the
       string matched and "<y>" the part not yet matched.  The "| 1: STAR"
       says that perl is at line number 1 n the compilation list above.  See
       "Debugging regular expressions" in perldebguts for much more detail.
       An alternative method of debugging regexps is to embed "print" state-
       ments within the regexp.  This provides a blow-by-blow account of the
       backtracking in an alternation:
           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;
       prints
           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4
BUGS
       Code expressions, conditional expressions, and independent expressions
       are experimental.  Don't use them in production code.  Yet.
SEE ALSO
       This is just a tutorial.  For the full story on perl regular expres-
       sions, see the perlre regular expressions reference page.
       For more information on the matching "m//" and substitution "s///"
       operators, see "Regexp Quote-Like Operators" in perlop.  For informa-
       tion on the "split" operation, see "split" in perlfunc.
       For an excellent all-around resource on the care and feeding of regular
       expressions, see the book Mastering Regular Expressions by Jeffrey
       Friedl (published by O'Reilly, ISBN 1556592-257-3).
AUTHOR AND COPYRIGHT
       Copyright (c) 2000 Mark Kvale All rights reserved.
       This document may be distributed under the same terms as Perl itself.
       Acknowledgments
       The inspiration for the stop codon DNA example came from the ZIP code
       example in chapter 7 of Mastering Regular Expressions.
       The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
       Haworth, Ronald J Kimball, and Joe Smith for all their helpful com-
       ments.

perl v5.8.8                       2008-12-18                      PERLRETUT(1)